WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Sequence Annotations in 3D: 1S1Y
Photoactivated chromophore conformation in Photoactive Yellow Protein (E46Q mutant) from 10 microseconds to 3 milliseconds
Chain
A [auth I]
Dna (5'(atcaatatccacctgcagatactaccaaaagtgtatttggaaactgctccatcaaaaggcatgttcagctggaatccagctgaacatgccttttgatggagcagtttccaaatacacttttggtagtatctgcaggtggatattgat)3') - Homo sapiens