3D PFV: 1S1Z

RCSB PDB Core Operations are funded by the U.S. National Science Foundation (DBI-2321666), the US Department of Energy (DE-SC0019749), and the National Cancer Institute, National Institute of Allergy and Infectious Diseases, and National Institute of General Medical Sciences of the National Institutes of Health under grant R01GM157729.

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Sequence Annotations in 3D: 1S1Z

Photoactivated chromophore conformation in Photoactive Yellow Protein (E46Q mutant) from 10 to 500 nanoseconds

Chain

A [auth I]

Dna (5'(atcaatatccacctgcagatactaccaaaagtgtatttggaaactgctccatcaaaaggcatgttcagctggaatccagctgaacatgccttttgatggagcagtttccaaatacacttttggtagtatctgcaggtggatattgat)3') - Homo sapiens

Help Back

Prepare Data

Validate Data

Deposit Data

Help and Resources