WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Model 1 / 2
Sequence Annotations in 3D: 1T18
Early intermediate IE1 from time-resolved crystallography of the E46Q mutant of PYP
Chain
A [auth I]
Dna (5'(atcaatatccacctgcagatactaccaaaagtgtatttggaaactgctccatcaaaaggcatgttcagctggaatccagctgaacatgccttttgatggagcagtttccaaatacacttttggtagtatctgcaggtggatattgat)3') - Homo sapiens