Annotations: 5BTA

Domain Annotation: SCOP2 Classification SCOP2 Database Homepage

Chains	Type	Family Name	Domain Identifier	Family Identifier	Provenance Source (Version)
D	SCOP2B Superfamily	Toprim domain-like	8090033	3000737	SCOP2B (2022-06-29)
B	SCOP2B Superfamily	Toprim domain-like	8090033	3000737	SCOP2B (2022-06-29)

Domain Annotation: ECOD Classification ECOD Database Homepage

Chains	Family Name	Domain Identifier	Architecture	Possible Homology	Homology	Topology	Family	Provenance Source (Version)
A	DNA_topoisoIV_1st	e5btaA3	A: alpha arrays	X: HTH	H: HTH	T: winged	F: DNA_topoisoIV_1st	ECOD (1.6)
A	DNA_topoisoIV_3rd	e5btaA2	A: alpha bundles	X: alpha-helical domain in type II DNA topoisomerase (From Topology)	H: alpha-helical domain in type II DNA topoisomerase (From Topology)	T: alpha-helical domain in type II DNA topoisomerase	F: DNA_topoisoIV_3rd	ECOD (1.6)
A	DNA_topoisoIV_2nd_1	e5btaA1	A: a+b two layers	X: a+b domain in type II DNA topoisomerase (From Topology)	H: a+b domain in type II DNA topoisomerase (From Topology)	T: a+b domain in type II DNA topoisomerase	F: DNA_topoisoIV_2nd_1	ECOD (1.6)
C	DNA_topoisoIV_1st	e5btaC3	A: alpha arrays	X: HTH	H: HTH	T: winged	F: DNA_topoisoIV_1st	ECOD (1.6)
C	DNA_topoisoIV_3rd	e5btaC1	A: alpha bundles	X: alpha-helical domain in type II DNA topoisomerase (From Topology)	H: alpha-helical domain in type II DNA topoisomerase (From Topology)	T: alpha-helical domain in type II DNA topoisomerase	F: DNA_topoisoIV_3rd	ECOD (1.6)
C	DNA_topoisoIV_2nd_1	e5btaC2	A: a+b two layers	X: a+b domain in type II DNA topoisomerase (From Topology)	H: a+b domain in type II DNA topoisomerase (From Topology)	T: a+b domain in type II DNA topoisomerase	F: DNA_topoisoIV_2nd_1	ECOD (1.6)
D	gyrB_1st_3	e5btaD2	A: a+b two layers	X: SSHS domain	H: SSHS domain in type II DNA topoisomerase (From Topology)	T: SSHS domain in type II DNA topoisomerase	F: gyrB_1st_3	ECOD (1.6)
D	DNA_gyraseB_C	e5btaD1	A: a/b three-layered sandwiches	X: HAD domain-like	H: HAD domain-related	T: Toprim domain	F: DNA_gyraseB_C	ECOD (1.6)
B	gyrB_1st_3	e5btaB1	A: a+b two layers	X: SSHS domain	H: SSHS domain in type II DNA topoisomerase (From Topology)	T: SSHS domain in type II DNA topoisomerase	F: gyrB_1st_3	ECOD (1.6)
B	DNA_gyraseB_C	e5btaB2	A: a/b three-layered sandwiches	X: HAD domain-like	H: HAD domain-related	T: Toprim domain	F: DNA_gyraseB_C	ECOD (1.6)

Domain Annotation: CATH CATH Database Homepage

Chain	Domain	Class	Architecture	Topology	Homology	Provenance Source (Version)
D	3.40.50.670	Alpha Beta	3-Layer(aba) Sandwich	Rossmann fold		CATH (4.3.0)
B	3.40.50.670	Alpha Beta	3-Layer(aba) Sandwich	Rossmann fold		CATH (4.3.0)

Protein Family Annotation Pfam Database Homepage

Chains	Accession	Name	Description	Comments	Source
A, C	PF00521	DNA gyrase/topoisomerase IV, subunit A (DNA_topoisoIV)	DNA gyrase/topoisomerase IV, subunit A	-	Family
B, D	PF00986	DNA gyrase B subunit, carboxyl terminus (DNA_gyraseB_C)	DNA gyrase B subunit, carboxyl terminus	-	Family
B, D	PF01751	Toprim domain (Toprim)	Toprim domain	-	Family

Gene Ontology: Gene Product Annotation Gene Ontology Database Homepage

Chains	Polymer	Molecular Function	Biological Process	Cellular Component
A, C	DNA gyrase subunit A	cation binding magnesium ion binding ion binding binding metal ion binding small molecule binding adenyl ribonucleotide binding nucleotide binding purine ribonucleotide binding purine ribonucleoside triphosphate binding nucleoside phosphate binding purine nucleotide binding organic cyclic compound binding anion binding cation binding magnesium ion binding ion binding binding metal ion binding small molecule binding adenyl ribonucleotide binding nucleotide binding purine ribonucleotide binding purine ribonucleoside triphosphate binding nucleoside phosphate binding purine nucleotide binding organic cyclic compound binding anion binding adenyl nucleotide binding ATP binding heterocyclic compound binding carbohydrate derivative binding ribonucleotide binding DNA binding nucleic acid binding ATP-dependent activity, acting on DNA isomerase activity DNA negative supercoiling activity catalytic activity, acting on DNA catalytic activity, acting on a nucleic acid DNA topoisomerase activity DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity catalytic activity ATP-dependent activity pyrophosphatase activity ATP hydrolysis activity ribonucleoside triphosphate phosphatase activity hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides hydrolase activity hydrolase activity, acting on acid anhydrides	response to stimulus response to chemical response to antibiotic nucleobase-containing compound metabolic process DNA-templated DNA replication DNA replication metabolic process cellular process primary metabolic process DNA metabolic process macromolecule metabolic process nucleic acid metabolic process chromosome organization DNA conformation change response to stimulus response to chemical response to antibiotic nucleobase-containing compound metabolic process DNA-templated DNA replication DNA replication metabolic process cellular process primary metabolic process DNA metabolic process macromolecule metabolic process nucleic acid metabolic process chromosome organization DNA conformation change cellular component organization DNA topological change organelle organization cellular component organization or biogenesis	intracellular organelle cellular anatomical structure intracellular anatomical structure organelle membraneless organelle intracellular membraneless organelle chromosome cell periphery plasma membrane membrane external encapsulating structure cell wall peptidoglycan-based cell wall cytoplasm intracellular organelle cellular anatomical structure intracellular anatomical structure organelle membraneless organelle intracellular membraneless organelle chromosome cell periphery plasma membrane membrane external encapsulating structure cell wall peptidoglycan-based cell wall cytoplasm DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex protein-containing complex catalytic complex
B, D	DNA gyrase subunit B	cation binding magnesium ion binding ion binding binding metal ion binding small molecule binding adenyl ribonucleotide binding nucleotide binding purine ribonucleotide binding purine ribonucleoside triphosphate binding nucleoside phosphate binding purine nucleotide binding organic cyclic compound binding anion binding cation binding magnesium ion binding ion binding binding metal ion binding small molecule binding adenyl ribonucleotide binding nucleotide binding purine ribonucleotide binding purine ribonucleoside triphosphate binding nucleoside phosphate binding purine nucleotide binding organic cyclic compound binding anion binding adenyl nucleotide binding ATP binding heterocyclic compound binding carbohydrate derivative binding ribonucleotide binding DNA binding nucleic acid binding ATP-dependent activity, acting on DNA isomerase activity DNA negative supercoiling activity catalytic activity, acting on DNA catalytic activity, acting on a nucleic acid DNA topoisomerase activity DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity catalytic activity ATP-dependent activity	response to stimulus response to chemical response to antibiotic nucleobase-containing compound metabolic process DNA-templated DNA replication DNA replication metabolic process cellular process primary metabolic process DNA metabolic process macromolecule metabolic process nucleic acid metabolic process chromosome organization DNA conformation change response to stimulus response to chemical response to antibiotic nucleobase-containing compound metabolic process DNA-templated DNA replication DNA replication metabolic process cellular process primary metabolic process DNA metabolic process macromolecule metabolic process nucleic acid metabolic process chromosome organization DNA conformation change cellular component organization DNA topological change organelle organization cellular component organization or biogenesis	cell periphery cellular anatomical structure plasma membrane membrane external encapsulating structure cell wall peptidoglycan-based cell wall intracellular anatomical structure cytoplasm intracellular organelle organelle membraneless organelle intracellular membraneless organelle chromosome
E, H	DNA substrate 24-mer GGTCATGAATGACTATGCACGTAA	-	-	-
F, G	DNA substrate 24-mer TTACGTGCATAGTCATTCATGACC	-	-	-

InterPro: Protein Family Classification InterPro Database Homepage

Chains	Accession	Name	Type
A, C	IPR035516	DNA gyrase/topoisomerase IV, subunit A, C-terminal	Homologous Superfamily
A, C	IPR050220	Type II DNA Topoisomerases	Family
A, C	IPR013760	DNA topoisomerase, type IIA-like domain superfamily	Homologous Superfamily
A, C	IPR013757	DNA topoisomerase, type IIA, alpha-helical domain superfamily	Homologous Superfamily
A, C	IPR013758	DNA topoisomerase, type IIA, domain A, alpha-beta	Homologous Superfamily
A, C	IPR005743	DNA gyrase, subunit A	Family
A, C	IPR006691	DNA gyrase/topoisomerase IV, subunit A, C-terminal repeat	Repeat
A, C	IPR002205	DNA topoisomerase, type IIA, domain A	Domain
B, D	IPR011557	DNA gyrase, subunit B	Family
B, D	IPR018522	DNA topoisomerase, type IIA, conserved site	Conserved Site
B, D	IPR013506	DNA topoisomerase, type IIA, subunit B, domain 2	Domain
B, D	IPR013760	DNA topoisomerase, type IIA-like domain superfamily	Homologous Superfamily
B, D	IPR036890	Histidine kinase/HSP90-like ATPase superfamily	Homologous Superfamily
B, D	IPR006171	TOPRIM domain	Domain
B, D	IPR000565	DNA topoisomerase, type IIA, subunit B	Family
B, D	IPR003594	Histidine kinase/HSP90-like ATPase domain	Domain
B, D	IPR020568	Ribosomal protein uS5 domain 2-type superfamily	Homologous Superfamily
B, D	IPR001241	DNA topoisomerase, type IIA	Family
B, D	IPR002288	DNA gyrase B subunit, C-terminal	Domain
B, D	IPR014721	Small ribosomal subunit protein uS5 domain 2-type fold, subgroup	Homologous Superfamily
B, D	IPR034160	DNA gyrase subunit B, TOPRIM domain	Domain
B, D	IPR013759	DNA topoisomerase, type IIA, subunit B, C-terminal	Homologous Superfamily