1KX4 | pdb_00001kx4

X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution


Domain Annotation: SCOP2 Classification SCOP2 Database Homepage

ChainsTypeFamily Name Domain Identifier Family IdentifierProvenance Source (Version)
J [auth H]SCOP2B SuperfamilyCore histone-like 8041279 3001387 SCOP2B (2022-06-29)
F [auth D]SCOP2B SuperfamilyCore histone-like 8041279 3001387 SCOP2B (2022-06-29)
I [auth G]SCOP2B SuperfamilyCore histone-like 8041278 3001387 SCOP2B (2022-06-29)
E [auth C]SCOP2B SuperfamilyCore histone-like 8041278 3001387 SCOP2B (2022-06-29)
H [auth F]SCOP2B SuperfamilyCore histone-like 8042439 3001387 SCOP2B (2022-06-29)
D [auth B]SCOP2B SuperfamilyCore histone-like 8042439 3001387 SCOP2B (2022-06-29)
G [auth E]SCOP2B SuperfamilyCore histone-like 8041272 3001387 SCOP2B (2022-06-29)
C [auth A]SCOP2B SuperfamilyCore histone-like 8041272 3001387 SCOP2B (2022-06-29)

Domain Annotation: ECOD Classification ECOD Database Homepage

ChainsFamily NameDomain Identifier ArchitecturePossible HomologyHomologyTopologyFamilyProvenance Source (Version)
J [auth H]Histonee1kx4H1 A: a/b three-layered sandwichesX: ETN0001 domain-likeH: alpha-2-Macroglobulin receptor associated protein (RAP) domain 1T: alpha-2-Macroglobulin receptor associated protein (RAP) domain 1F: HistoneECOD (v294.1)
F [auth D]Histonee1kx4D1 A: a/b three-layered sandwichesX: ETN0001 domain-likeH: alpha-2-Macroglobulin receptor associated protein (RAP) domain 1T: alpha-2-Macroglobulin receptor associated protein (RAP) domain 1F: HistoneECOD (v294.1)
I [auth G]Histonee1kx4G1 A: a/b three-layered sandwichesX: ETN0001 domain-likeH: alpha-2-Macroglobulin receptor associated protein (RAP) domain 1T: alpha-2-Macroglobulin receptor associated protein (RAP) domain 1F: HistoneECOD (v294.1)
E [auth C]Histonee1kx4C1 A: a/b three-layered sandwichesX: ETN0001 domain-likeH: alpha-2-Macroglobulin receptor associated protein (RAP) domain 1T: alpha-2-Macroglobulin receptor associated protein (RAP) domain 1F: HistoneECOD (v294.1)
H [auth F]e1kx4F1 A: a/b three-layered sandwichesX: ETN0001 domain-likeH: alpha-2-Macroglobulin receptor associated protein (RAP) domain 1T: alpha-2-Macroglobulin receptor associated protein (RAP) domain 1F:ECOD (v294.1)
D [auth B]e1kx4B1 A: a/b three-layered sandwichesX: ETN0001 domain-likeH: alpha-2-Macroglobulin receptor associated protein (RAP) domain 1T: alpha-2-Macroglobulin receptor associated protein (RAP) domain 1F:ECOD (v294.1)
G [auth E]Histonee1kx4E1 A: a/b three-layered sandwichesX: ETN0001 domain-likeH: alpha-2-Macroglobulin receptor associated protein (RAP) domain 1T: alpha-2-Macroglobulin receptor associated protein (RAP) domain 1F: HistoneECOD (v294.1)
C [auth A]Histonee1kx4A1 A: a/b three-layered sandwichesX: ETN0001 domain-likeH: alpha-2-Macroglobulin receptor associated protein (RAP) domain 1T: alpha-2-Macroglobulin receptor associated protein (RAP) domain 1F: HistoneECOD (v294.1)

Domain Annotation: CATH CATH Database Homepage

Protein Family Annotation Pfam Database Homepage

ChainsAccessionNameDescriptionCommentsSource
E [auth C],
I [auth G]
PF16211C-terminus of histone H2A (Histone_H2A_C)C-terminus of histone H2A- Family
D [auth B],
H [auth F]
PF15511Centromere kinetochore component CENP-T histone fold (CENP-T_C)Centromere kinetochore component CENP-T histone foldCENP-T is a family of vertebral kinetochore proteins that associates directly with CENP-W. The N-terminus of CENP-T proteins interacts directly with the Ndc80 complex in the outer kinetochore. Importantly, the CENP-T-W complex does not directly asso ...CENP-T is a family of vertebral kinetochore proteins that associates directly with CENP-W. The N-terminus of CENP-T proteins interacts directly with the Ndc80 complex in the outer kinetochore. Importantly, the CENP-T-W complex does not directly associate with CENP-A, but with histone H3 in the centromere region. CENP-T and -W form a hetero-tetramer with CENP-S and -X and bind to a ~100 bp region of nucleosome-free DNA forming a nucleosome-like structure. The DNA-CENP-T-W-S-X complex is likely to be associated with histone H3-containing nucleosomes rather than with CENP-nucleosomes. This domain is the C-terminal histone fold domain of CENP-T, which associates with chromatin [2-3].
Domain
C [auth A],
G [auth E]
PF00125Core histone H2A/H2B/H3/H4 domain (Histone)Core histone H2A/H2B/H3/H4 domainDomain

Gene Ontology: Gene Product Annotation Gene Ontology Database Homepage

ChainsPolymerMolecular FunctionBiological ProcessCellular Component
F [auth D],
J [auth H]
histone H2B.2 -
E [auth C],
I [auth G]
histone H2A.1
D [auth B],
H [auth F]
histone H4
C [auth A],
G [auth E]
histone H3 -
A [auth I],
B [auth J]
DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3')---